Stem-loop sequence bta-mir-190b

AccessionMI0009763 (change log)
DescriptionBos taurus miR-190b stem-loop
Gene family MIPF0000076; mir-190
Literature search

2 open access papers mention bta-mir-190b
(8 sentences)

Stem-loop
   -    u     -u               g     -   aa 
5'  ugcu cugug  gauauguuugauauu gguug uuu  u
    |||| |||||  ||||||||||||||| ||||| |||   
3'  auga gacau  uuauacaaacuguaa ucaac aag  u
   g    c     uc               a     c   ga 
Get sequence
Deep sequencing
134 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 16531292-16531370 [+]
sense
ENSBTAT00000051775 ; bta-mir-190b-201; exon 1
Database links

Mature sequence bta-miR-190b

Accession MIMAT0009252
Sequence

11 - 

ugauauguuugauauuggguu

 - 31

Get sequence
Deep sequencing134 reads, 51 experiments
Evidence experimental; Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).