Stem-loop sequence bta-mir-24-1

AccessionMI0009761 (change log)
DescriptionBos taurus miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Literature search

24 open access papers mention bta-mir-24-1
(51 sentences)

Stem-loop
       g  g   a         ua     ucuca 
5' cucc gu ccu cugagcuga  ucagu     u
   |||| || ||| |||||||||  |||||     u
3' gagg ca gga gacuugacu  gguca     u
       a  a   c         -c     cacau 
Get sequence
Deep sequencing
86489 reads, 561 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 83484370-83484437 [+]
sense
antisense
ENSBTAT00000042333 ; bta-mir-24-1-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-24-1
bta-mir-2475chr8: 83482947-83483017 [+]
bta-mir-10174chr8: 83483597-83483678 [+]
bta-mir-27bchr8: 83483816-83483912 [+]
bta-mir-24-1chr8: 83484370-83484437 [+]
Database links

Mature sequence bta-miR-24

Accession MIMAT0009250
Sequence

6 - 

gugccuacugagcugauaucagu

 - 28

Get sequence
Deep sequencing414 reads, 63 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).