Stem-loop sequence bta-mir-188

AccessionMI0009760 (change log)
DescriptionBos taurus miR-188 stem-loop
Gene family MIPF0000113; mir-188
Literature search

3 open access papers mention bta-mir-188
(4 sentences)

Stem-loop
   u    -  uc   ca  uc         gu      -ugag u 
5'  gcuc cc  ucu  ca  ccuugcaug  ggaggg     c u
    |||| ||  |||  ||  |||||||||  ||||||     | u
3'  cgag gg  agg  gu  gggacguac  ccuccc     g c
   c    u  -u   ac  uu         ac      caaaa u 
Get sequence
Deep sequencing
474 reads, 2.9 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 93935739-93935824 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-188
bta-mir-532chrX: 93935413-93935498 [+]
bta-mir-188chrX: 93935739-93935824 [+]
bta-mir-502a-2chrX: 93942730-93942819 [+]
Database links

Mature sequence bta-miR-188

Accession MIMAT0009249
Sequence

15 - 

caucccuugcaugguggagggu

 - 36

Get sequence
Deep sequencing407 reads, 66 experiments
Evidence experimental; Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).