Stem-loop sequence bta-mir-187

AccessionMI0009759 (change log)
DescriptionBos taurus miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   ggccgggcuccccacgacacggu   aga    g    a           - --c   -  cu 
5'                        gug   ccuc ggcu caacacgggac c   ggg cg  g
                          |||   |||| |||| ||||||||||| |   ||| ||   
3'                        cgc   ggag ccga guuguguucug g   ccc gc  c
   --------------acgccugaa   -ag    g    c           u cuc   a  cu 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 21595499-21595607 [+]
intergenic
Database links

Mature sequence bta-miR-187

Accession MIMAT0009248
Sequence

71 - 

ucgugucuuguguugcagccgg

 - 92

Get sequence
Deep sequencing34 reads, 20 experiments
Evidence by similarity; MI0000274
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).