Stem-loop sequence bta-mir-185

AccessionMI0009758 (change log)
DescriptionBos taurus miR-185 stem-loop
Gene family MIPF0000202; mir-185
Literature search

7 open access papers mention bta-mir-185
(9 sentences)

Stem-loop
        u     a      a     g         au  uc 
5' ggggg gaggg cuggag gaaag caguuccug  gg  c
   ||||| ||||| |||||| ||||| |||||||||  ||   
3' ccuuc cuccc ggccuc cuuuc gucggggac  cc  c
        -     c      -     g         -c  uc 
Get sequence
Deep sequencing
25458 reads, 80.6 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 75173467-75173545 [+]
intergenic
Database links

Mature sequence bta-miR-185

Accession MIMAT0009247
Sequence

14 - 

uggagagaaaggcaguuccuga

 - 35

Get sequence
Deep sequencing25154 reads, 72 experiments
Evidence by similarity; MI0000482
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).