Stem-loop sequence bta-mir-184

AccessionMI0009757 (change log)
DescriptionBos taurus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

12 open access papers mention bta-mir-184
(31 sentences)

Stem-loop
   c       auc         c      ag     uuu  ga 
5'  cagucac   cccuuauca uuuucc  ccagc   gu  c
    |||||||   ||||||||| ||||||  |||||   ||  u
3'  guuagug   gggaauagu aagagg  gguug   ca  c
   a       gau         c      ca     --u  au 
Get sequence
Deep sequencing
3002 reads, 11.5 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 25988851-25988933 [+]
intergenic
Database links

Mature sequence bta-miR-184

Accession MIMAT0009246
Sequence

52 - 

uggacggagaacugauaagggu

 - 73

Get sequence
Deep sequencing3002 reads, 52 experiments
Evidence by similarity; MI0000481
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).