Stem-loop sequence bta-mir-183

AccessionMI0009756 (change log)
DescriptionBos taurus miR-183 stem-loop
Gene family MIPF0000066; mir-183
Literature search

5 open access papers mention bta-mir-183
(46 sentences)

Stem-loop
       g      --ac     ga        --   ac 
5' cugu uauggc    uggua  auucacug  uga  a
   |||| ||||||    |||||  ||||||||  |||   
3' gaca auaccg    gccau  uaagugac  gcu  g
       a      ggaa     --        ug   cu 
Get sequence
Deep sequencing
10367 reads, 45.9 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 94724660-94724729 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-183
bta-mir-183chr4: 94724660-94724729 [-]
bta-mir-96chr4: 94724422-94724524 [-]
bta-mir-182chr4: 94719929-94720039 [-]
Database links

Mature sequence bta-miR-183

Accession MIMAT0009245
Sequence

6 - 

uauggcacugguagaauucacug

 - 28

Get sequence
Deep sequencing10305 reads, 74 experiments
Evidence by similarity; MI0000928
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).