Stem-loop sequence bta-mir-181d

AccessionMI0009754 (change log)
DescriptionBos taurus miR-181d stem-loop
Gene family MIPF0000007; mir-181
Literature search

19 open access papers mention bta-mir-181d
(43 sentences)

Stem-loop
   uccccucccuua    a    gaaggu    auca         g ug          g  aca 
5'             ggcc cagc      caca    acauucauu u  ucgguggguu ug   g
               |||| ||||      ||||    ||||||||| |  |||||||||| ||    
3'             ccgg gucg      gugu    uguaaguag g  agccacccag ac   a
   ------cacaga    -    ------    -cac         g --          -  cag 
Get sequence
Deep sequencing
54064 reads, 393 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 12978911-12979023 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-181d
bta-mir-181cchr7: 12978745-12978841 [+]
bta-mir-181dchr7: 12978911-12979023 [+]
Database links

Mature sequence bta-miR-181d

Accession MIMAT0009243
Sequence

35 - 

aacauucauuguugucggugggu

 - 57

Get sequence
Deep sequencing54058 reads, 76 experiments
Evidence by similarity; MI0003139
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).