Stem-loop sequence bta-mir-16a

AccessionMI0009753 (change log)
DescriptionBos taurus miR-16a stem-loop
Gene family MIPF0000006; mir-15
Literature search

25 open access papers mention bta-mir-16a
(61 sentences)

Stem-loop
         ag   c          -  a        u u   gauu 
5' gucagc  ugc uuagcagcac gu aauauugg g uaa    c
   ||||||  ||| |||||||||| || |||||||| | |||     
3' cgguug  aug agucgucgug ca uuaugacc c auu    u
         ga   a          u  a        u u   aaaa 
Get sequence
Deep sequencing
181902 reads, 2.12e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 19660386-19660474 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-16a
bta-mir-15achr12: 19660532-19660614 [-]
bta-mir-16achr12: 19660386-19660474 [-]
Database links

Mature sequence bta-miR-16a

Accession MIMAT0009242
Sequence

14 - 

uagcagcacguaaauauuggug

 - 35

Get sequence
Deep sequencing181622 reads, 76 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).