Stem-loop sequence bta-mir-155

AccessionMI0009752 (change log)
DescriptionBos taurus miR-155 stem-loop
Gene family MIPF0000157; mir-155
Literature search

39 open access papers mention bta-mir-155
(219 sentences)

Stem-loop
   u           u    a        uuua c 
5'  guuaaugcuaa cgug uagggguu    c u
    ||||||||||| |||| ||||||||    |  
3'  caauuacgauu guac auccucag    g c
   a           -    -        -uca g 
Get sequence
Deep sequencing
19453 reads, 116 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 10259259-10259321 [-]
sense
ENSBTAT00000050904 ; bta-mir-155-201; exon 1
Database links

Mature sequence bta-miR-155

Accession MIMAT0009241
Sequence

3 - 

uuaaugcuaaucgugauaggggu

 - 25

Get sequence
Deep sequencing19437 reads, 70 experiments
Evidence by similarity; MI0001176
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).