Stem-loop sequence bta-mir-153-2

AccessionMI0009750 (change log)
DescriptionBos taurus miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Literature search

5 open access papers mention bta-mir-153-2
(7 sentences)

Stem-loop
   a     gg      -             gu       -a  aa 
5'  gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
    |||||  |||||| |||||||||||||  |||||||  ||  a
3'  uguca  gguuac agugaaaacacug  acguuga  cg  u
   g     aa      u             au       cc  ag 
Get sequence
Deep sequencing
981 reads, 1.64 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 119976209-119976295 [-]
sense
ENSBTAT00000055262 ; PTPRN2-201; intron 5
Database links

Mature sequence bta-miR-153

Accession MIMAT0009239
Sequence

53 - 

uugcauagucacaaaagugauc

 - 74

Get sequence
Deep sequencing1934 reads, 61 experiments
Evidence experimental; Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).