Stem-loop sequence bta-mir-152

AccessionMI0009748 (change log)
DescriptionBos taurus miR-152 stem-loop
Gene family MIPF0000056; mir-148
Literature search

18 open access papers mention bta-mir-152
(198 sentences)

Stem-loop
   u    -   c              g  a    cc    cgg   c 
5'  gucc ucc ggcccagguucugu au cacu  gacu   gcu u
    |||| ||| |||||||||||||| || ||||  ||||   |||  
3'  cagg agg ccggguucaagaca ua guga  cuga   cga g
   c    c   c              g  c    --    ---   g 
Get sequence
Deep sequencing
53726 reads, 171 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 39247030-39247115 [+]
sense
ENSBTAT00000056479 ; COPZ2-201; intron 1
Clustered miRNAs
< 10kb from bta-mir-152
bta-mir-152chr19: 39247030-39247115 [+]
bta-mir-148cchr19: 39247037-39247107 [-]
Database links

Mature sequence bta-miR-152

Accession MIMAT0009238
Sequence

53 - 

ucagugcaugacagaacuuggg

 - 74

Get sequence
Deep sequencing52923 reads, 75 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).