Stem-loop sequence bta-mir-146a

AccessionMI0009746 (change log)
DescriptionBos taurus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

32 open access papers mention bta-mir-146a
(200 sentences)

Stem-loop
   -----cccaugu      u     uu            c        g  uc 
5'             guaucc cagcu  gagaacugaauu cauagguu ug  a
               |||||| |||||  |||||||||||| |||||||| ||  g
3'             uauagg gucga  uucuugauuuga guguccag ac  u
   uccuacuaucuc      -     -u            a        -  ug 
Get sequence
Deep sequencing
96710 reads, 1.23e+03 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 74529534-74529632 [+]
intergenic
Database links

Mature sequence bta-miR-146a

Accession MIMAT0009236
Sequence

21 - 

ugagaacugaauuccauagguugu

 - 44

Get sequence
Deep sequencing96668 reads, 75 experiments
Evidence by similarity; MI0000477
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).