Stem-loop sequence bta-mir-143

AccessionMI0009743 (change log)
DescriptionBos taurus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

37 open access papers mention bta-mir-143
(121 sentences)

Stem-loop
   ---  - uc --ug      ag      g         g      u  -  ag 
5'    gc g  c    ucuccc  ccugag ugcagugcu caucuc gg uc  u
      || |  |    ||||||  |||||| ||||||||| |||||| || ||   
3'    cg c  g    agaggg  gggcuc augucacga guagag cu ag  u
   cga  u uu uuga      aa      g         a      u  g  gg 
Get sequence
Deep sequencing
33324495 reads, 2.88e+05 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 63079071-63079171 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-143
bta-mir-143chr7: 63079071-63079171 [+]
bta-mir-145chr7: 63080500-63080587 [+]
Database links

Mature sequence bta-miR-143

Accession MIMAT0009233
Sequence

56 - 

ugagaugaagcacuguagcucg

 - 77

Get sequence
Deep sequencing33317290 reads, 75 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).