Stem-loop sequence bta-mir-141

AccessionMI0009742 (change log)
DescriptionBos taurus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Literature search

15 open access papers mention bta-mir-141
(37 sentences)

Stem-loop
   ga      cu   u       --    c        -   ugg  ua 
5'   ccggcu  ggg ccaucuu  ccag acaguguu gga   uc  a
     ||||||  ||| |||||||  |||| |||||||| |||   ||  u
3'   ggucgg  ccc gguagaa  gguc ugucacaa ccu   ag  g
   --      cc   -       au    -        u   cga  ug 
Get sequence
Deep sequencing
315015 reads, 8.54e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 104149742-104149831 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-141
bta-mir-200cchr5: 104150173-104150237 [-]
bta-mir-141chr5: 104149742-104149831 [-]
Database links

Mature sequence bta-miR-141

Accession MIMAT0009232
Sequence

58 - 

uaacacugucugguaaagaugg

 - 79

Get sequence
Deep sequencing314175 reads, 78 experiments
Evidence by similarity; MI0000457
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).