Stem-loop sequence bta-mir-137

AccessionMI0009740 (change log)
DescriptionBos taurus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

3 open access papers mention bta-mir-137
(4 sentences)

Stem-loop
   g u  u   --           ug   g           ug a     -  g 
5'  g cc cug  acucucuucgg  acg guauucuuggg  g uaaua cg a
    | || |||  |||||||||||  ||| |||||||||||  | ||||| || u
3'  c gg gac  ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   a -  c   ca           ga   g           gu -     u  a 
Get sequence
Deep sequencing
170 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 45682235-45682336 [+]
intergenic
Database links

Mature sequence bta-miR-137

Accession MIMAT0009231
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Deep sequencing170 reads, 52 experiments
Evidence by similarity; MI0000454
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).