Stem-loop sequence bta-mir-136

AccessionMI0009739 (change log)
DescriptionBos taurus miR-136 stem-loop
Gene family MIPF0000099; mir-136
Literature search

4 open access papers mention bta-mir-136
(6 sentences)

Stem-loop
   uug    -       g        c     uuu          uuc 
5'    gaug agcccuc gaggacuc auuug   ugaugaugga   u
      |||| ||||||| |||||||| |||||   ||||||||||   u
3'    cuac uugggag cuucugag uaaac   gcuacuaccu   a
   -ua    c       a        -     ucu          cgc 
Get sequence
Deep sequencing
40775 reads, 280 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67710178-67710269 [+]
antisense
ENSBTAT00000065107 ; bta-mir-433-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-136
bta-mir-665chr21: 67702209-67702280 [+]
bta-mir-431chr21: 67706530-67706643 [+]
bta-mir-433chr21: 67707406-67707529 [+]
bta-mir-127chr21: 67708504-67708598 [+]
bta-mir-432chr21: 67709994-67710083 [+]
bta-mir-136chr21: 67710178-67710269 [+]
Database links

Mature sequence bta-miR-136

Accession MIMAT0009230
Sequence

20 - 

acuccauuuguuuugaugaugga

 - 42

Get sequence
Deep sequencing6505 reads, 64 experiments
Evidence by similarity; MI0000475
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).