Stem-loop sequence bta-mir-135a-1

AccessionMI0009737 (change log)
DescriptionBos taurus miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Literature search

8 open access papers mention bta-mir-135a-1
(25 sentences)

Stem-loop
   a g         u u          uu            uucua 
5'  g ccucgcugu c cuauggcuuu  auuccuauguga     c
    | ||||||||| | ||||||||||  ||||||||||||     u
3'  c ggggcggca g ggugccgagg  uagggauauacu     g
   a g         c c          -u            cacuc 
Get sequence
Deep sequencing
221 reads, 1.61 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 49324825-49324914 [+]
intergenic
Database links

Mature sequence bta-miR-135a

Accession MIMAT0009228
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Deep sequencing360 reads, 57 experiments
Evidence by similarity; MI0000452
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).