Stem-loop sequence bta-mir-135a-2

AccessionMI0009736 (change log)
DescriptionBos taurus miR-135a-2 stem-loop
Gene family MIPF0000028; mir-135
Literature search

8 open access papers mention bta-mir-135a-2
(25 sentences)

Stem-loop
   a   aaa     ucua   c            u            u g a 
5'  gau   uucac    gug uuuauggcuuuu auuccuauguga a u a
    |||   |||||    ||| |||||||||||| |||||||||||| | | u
3'  cua   aagug    cau aaguaccgaagg uagggauguacu u a a
   a   -aa     -uua   a            -            c g a 
Get sequence
Deep sequencing
189 reads, 5.17 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 62308981-62309080 [+]
intergenic
Database links

Mature sequence bta-miR-135a

Accession MIMAT0009228
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing360 reads, 57 experiments
Evidence by similarity; MI0000452
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).