Stem-loop sequence bta-mir-134

AccessionMI0009735 (change log)
DescriptionBos taurus miR-134 stem-loop
Gene family MIPF0000112; mir-134
Literature search

2 open access papers mention bta-mir-134
(10 sentences)

Stem-loop
   c     gu        u  -a      u  cc   a 
5'  agggu  gugacugg ug  ccagag gg  agc c
    |||||  |||||||| ||  |||||| ||  ||| u
3'  uccca  cacugauc ac  ggucuc cc  uug c
   c     ac        c  cg      -  ac   g 
Get sequence
Deep sequencing
237 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67871630-67871702 [+]
sense
ENSBTAT00000042168 ; bta-mir-134-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-134
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
bta-mir-377chr21: 67878863-67878931 [+]
bta-mir-541chr21: 67880717-67880800 [+]
bta-mir-3957chr21: 67881103-67881179 [+]
bta-mir-409achr21: 67881619-67881697 [+]
bta-mir-409bchr21: 67881619-67881697 [-]
Database links

Mature sequence bta-miR-134

Accession MIMAT0009227
Sequence

8 - 

ugugacugguugaccagagugg

 - 29

Get sequence
Deep sequencing163 reads, 44 experiments
Evidence by similarity; MI0010382
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).