Stem-loop sequence bta-mir-133a-2

AccessionMI0009732 (change log)
DescriptionBos taurus miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Literature search

23 open access papers mention bta-mir-133a-2
(97 sentences)

Stem-loop
   -      uuu    g       aa  u  a        gccuc 
5'  caaugc   gcua agcuggu  aa gg accaaauc     u
    ||||||   |||| |||||||  || || ||||||||      
3'  guuacg   cgau ucgacca  uu cc ugguuuag     u
   a      uau    g       ac  c  c        guaac 
Get sequence
Deep sequencing
35691 reads, 259 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 34932166-34932252 [+]
antisense
ENSBTAT00000009822 ; MIB1-201; intron 12
Clustered miRNAs
< 10kb from bta-mir-133a-2
bta-mir-1-2chr24: 34928847-34928931 [+]
bta-mir-133a-2chr24: 34932166-34932252 [+]
Database links

Mature sequence bta-miR-133a

Accession MIMAT0009225
Sequence

52 - 

uuugguccccuucaaccagcug

 - 73

Get sequence
Deep sequencing71044 reads, 66 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).