Stem-loop sequence bta-mir-130a

AccessionMI0009730 (change log)
DescriptionBos taurus miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

13 open access papers mention bta-mir-130a
(29 sentences)

Stem-loop
   u      -      a        c      ug  a   ucu  g 
5'  gcugcg ggccgg gcucuuuu acauug  cu cug   gc c
    |||||| |||||| |||||||| ||||||  || |||   ||  
3'  cgacgu ucgguu cgggaaaa uguaac  ga gau   ug c
   g      g      a        u      gu  c   cac  u 
Get sequence
Deep sequencing
52604 reads, 356 reads per million, 70 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 82581436-82581524 [+]
intergenic
Database links

Mature sequence bta-miR-130a

Accession MIMAT0009223
Sequence

55 - 

cagugcaauguuaaaagggcau

 - 76

Get sequence
Deep sequencing52576 reads, 70 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).