Stem-loop sequence bta-mir-129-2

Accession MI0009729
Description Bos taurus miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-129_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--cu             -       c   cu      ---     acau 
    gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
    ||||||||||||| ||||||| |||  ||||||   |||||     
    cgggaggcgcuua gaaaaac cca  cccgaa   cgaua    a
cacg             c       c   uu      ggc     acuc 
Get sequence
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr15: 74545185-74545278 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-129-2
bta-mir-6528 chr15: 74543906-74543987 [+]
bta-mir-129-2 chr15: 74545185-74545278 [+]
Database links

Mature sequence bta-miR-129-5p

Accession MIMAT0009221
Sequence

16 - 

cuuuuugcggucugggcuugcu

 - 37

Get sequence
Evidence experimental; cloned [3]

Mature sequence bta-miR-129-3p

Accession MIMAT0009222
Sequence

58 - 

aagcccuuaccccaaaaagcau

 - 79

Get sequence
Evidence experimental; cloned [3]

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).