Stem-loop sequence bta-mir-128-2

AccessionMI0009727 (change log)
DescriptionBos taurus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Literature search

7 open access papers mention bta-mir-128-2
(16 sentences)

Stem-loop
   u ug       a          agg      cc    g gag 
5'  g  caguggg aggggggccg   cacugu  gaga u   u
    |  ||||||| ||||||||||   ||||||  |||| |    
3'  u  gucaucc uuucucuggc   gugaca  cucu g   a
   c gu       c          caa      --    g acg 
Get sequence
Deep sequencing
22005 reads, 119 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 9796002-9796085 [+]
sense
ENSBTAT00000010173 ; ARPP21-203; intron 15
ENSBTAT00000061057 ; ARPP21-202; intron 18
Database links

Mature sequence bta-miR-128

Accession MIMAT0003541
Previous IDsbta-miR-128a
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Deep sequencing44102 reads, 74 experiments
Evidence experimental; Array [2], qRT-PCR [2], cloned [3]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).