Stem-loop sequence bta-mir-124a-2

AccessionMI0009725 (change log)
Previous IDsbta-mir-104-2
DescriptionBos taurus miR-124a-2 stem-loop
Gene family MIPF0000021; mir-124
Literature search

8 open access papers mention bta-mir-124a-2
(10 sentences)

Stem-loop
   ----------aucaagaucagac     c  cc        a   ga        uaau 
5'                        ucugc cu  guguucac gcg  ccuugauu    g
                          ||||| ||  |||||||| |||  ||||||||    u
3'                        aggcg ga  cguaagug cgc  ggaauuaa    c
   aaguucacgucggcggacauccg     a  ac        g   ac        caua 
Get sequence
Deep sequencing
192 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was mis-named bta-mir-104-2 in [1].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 31015073-31015183 [+]
intergenic
Database links

Mature sequence bta-miR-124a

Accession MIMAT0003811
Sequence

60 - 

uaaggcacgcggugaaugccaag

 - 82

Get sequence
Deep sequencing382 reads, 50 experiments
Evidence experimental; cloned [2,4], Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).