Stem-loop sequence bta-mir-106b

AccessionMI0009724 (change log)
DescriptionBos taurus miR-106b stem-loop
Gene family MIPF0000001; mir-17
Literature search

13 open access papers mention bta-mir-106b
(22 sentences)

Stem-loop 
              -ua       g       a a     guc 
5' ccugccggggc   aagugcu acagugc g uagug   c
   |||||||||||   ||||||| ||||||| | |||||    
3' ggacggccucg   uucaugg ugucacg c aucgu   u
              ucg       g       c -     gug
Get sequence
Deep sequencing
23674 reads, 133 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 37072314-37072393 [+]
sense
ENSBTAT00000003728 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from bta-mir-106b
bta-mir-106bchr25: 37072314-37072393 [+]
bta-mir-93chr25: 37072517-37072593 [+]
bta-mir-25chr25: 37072717-37072800 [+]
Database links

Mature sequence bta-miR-106b

Accession MIMAT0009218
Sequence

12 -  

uaaagugcugacagugcagau

 - 32

Get sequence
Deep sequencing15394 reads, 73 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).