Stem-loop sequence bta-mir-106b

Accession MI0009724
Description Bos taurus miR-106b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs..

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
           -ua       g       a a     guc 
ccugccggggc   aagugcu acagugc g uagug   c
|||||||||||   ||||||| ||||||| | |||||    
ggacggccucg   uucaugg ugucacg c aucgu   u
           ucg       g       c -     gug 
Get sequence
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr25: 36892046-36892125 [+]
sense
ENSBTAT00000003728 ; MCM7_BOVIN; intron 13
ENSBTAT00000003728 ; MCM7_BOVIN; intron 13
Clustered miRNAs
< 10kb from bta-mir-106b
bta-mir-106b chr25: 36892046-36892125 [+]
bta-mir-93 chr25: 36892249-36892325 [+]
bta-mir-25 chr25: 36892449-36892532 [+]
Database links

Mature sequence bta-miR-106b

Accession MIMAT0009218
Sequence

12 - 

uaaagugcugacagugcagau

 - 32

Get sequence
Evidence experimental; cloned [2]

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).