Stem-loop sequence bta-mir-105a

AccessionMI0009723 (change log)
DescriptionBos taurus miR-105a stem-loop
Gene family MIPF0000074; mir-105
Literature search

1 open access papers mention bta-mir-105a
(1 sentences)

Stem-loop
   ugu         u  a          uc        g ug 
5'    gcaucguag ca augcucagac  cuguggug c  c
      ||||||||| || ||||||||||  |||||||| |  u
3'    uguggcauc gu uacgaguuug  ggcaccac g  c
   auc         -  g          ua        - ua 
Get sequence
Deep sequencing
136 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 35236061-35236141 [-]
sense
ENSBTAT00000008798 ; GABRA3-201; intron 1
Clustered miRNAs
< 10kb from bta-mir-105a
bta-mir-105bchrX: 35238515-35238594 [-]
bta-mir-767chrX: 35237578-35237682 [-]
bta-mir-105achrX: 35236061-35236141 [-]
Database links

Mature sequence bta-miR-105a

Accession MIMAT0009217
Sequence

13 - 

ucaaaugcucagacuccuguggu

 - 35

Get sequence
Deep sequencing111 reads, 43 experiments
Evidence by similarity; MI0010377
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).