Stem-loop sequence bta-mir-101-1

AccessionMI0009721 (change log)
DescriptionBos taurus miR-101-1 stem-loop
Gene family MIPF0000046; mir-101
Literature search

13 open access papers mention bta-mir-101-1
(33 sentences)

Stem-loop
   a       cuggc                  a    gucca 
5'  ggcugcc     ucaguuaucacagugcug ugcu     u
    |||||||     |||||||||||||||||| ||||      
3'  ccgacgg     agucaauagugucaugac augg     u
   a       uagga                  -    aaauc 
Get sequence
Deep sequencing
213967 reads, 1.76e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 80980185-80980267 [+]
intergenic
Database links

Mature sequence bta-miR-101

Accession MIMAT0003520
Sequence

51 - 

uacaguacugugauaacugaa

 - 71

Get sequence
Deep sequencing426357 reads, 78 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).