Stem-loop sequence bta-mir-1-1

AccessionMI0009719 (change log)
DescriptionBos taurus miR-1-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

29 open access papers mention bta-mir-1-1
(133 sentences)

Stem-loop
   g    gg a                gc     ---   a 
5'  cuug  a acauacuucuuuaugu  ccaua   ugg c
    ||||  | ||||||||||||||||  |||||   ||| c
3'  ggac  u uguaugaagaaaugua  gguau   auc u
   -    uu a                -a     cga   g 
Get sequence
Deep sequencing
17402 reads, 54.5 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 55456488-55456563 [-]
intergenic
Database links

Mature sequence bta-miR-1

Accession MIMAT0009214
Sequence

49 - 

uggaauguaaagaaguauguau

 - 70

Get sequence
Deep sequencing34804 reads, 66 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).