Stem-loop sequence osa-MIR1319a

AccessionMI0009716 (change log)
Previous IDsosa-MIR1319
DescriptionOryza sativa miR1319 stem-loop
Gene family MIPF0001448; MIR1319
Literature search

2 open access papers mention osa-MIR1319a
(2 sentences)

Stem-loop
   -u               uaa             uc                 g      aa 
5'   augggugucgguuuu   gaaaaaaccggca  uguaauauauuauaggu ucgguu  u
     |||||||||||||||   |||||||||||||  ||||||||||||||||| ||||||  u
3'   uauccacagccaaaa   uuuuuuuggccgu  auauuauauaauaucca agccaa  a
   uc               ---             ga                 g      aa 
Get sequence
Deep sequencing
155 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 702071-702191 [-]
intergenic
Database links

Mature sequence osa-miR1319a

Accession MIMAT0009136
Previous IDsosa-miR1319
Sequence

25 - 

aaccggcaucuguaauauauuaua

 - 48

Get sequence
Deep sequencing43 reads, 2 experiments
Evidence experimental; 454 [1]
Database links

References

1
PMID:18323537 "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa" Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ Genome Res. 18:571-584(2008).