Stem-loop sequence dya-mir-11

AccessionMI0009703 (change log)
DescriptionDrosophila yakuba miR-11 stem-loop
Gene family MIPF0000252; mir-11
Stem-loop
     a    u         ucu      cc    u  acu 
5' gc cuug caagaacuu   cuguga  ugcg gu   u
   || |||| |||||||||   ||||||  |||| ||    
3' cg gagu guucuugag   gacacu  acgc cg   a
     c    c         ucu      --    -  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3R: 6285774-6285848 [-]
intergenic
Database links

Mature sequence dya-miR-11

Accession MIMAT0009123
Sequence

48 - 

caucacagucugaguucuugc

 - 68

Get sequence
Evidence by similarity; MI0000131

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).