Stem-loop sequence dya-mir-184

AccessionMI0009702 (change log)
DescriptionDrosophila yakuba miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   cc    c  u  ua         -     u  -  ccg   g au 
5'   ggug au cg  cccuuauca uucuc cg cc   ugu c  u
     |||| || ||  ||||||||| ||||| || ||   ||| |   
3'   ccac ua gc  gggaauagu aagag gc gg   aca g  g
   aa    -  u  uc         c     -  a  uca   - aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 7742268-7742354 [+]
intergenic
Database links

Mature sequence dya-miR-184-5p

Accession MIMAT0009121
Previous IDsdya-miR-184*
Sequence

16 - 

ccuuaucauucucucgccccg

 - 36

Get sequence
Evidence by similarity; MI0000354

Mature sequence dya-miR-184-3p

Accession MIMAT0009122
Previous IDsdya-miR-184
Sequence

54 - 

uggacggagaacugauaagggc

 - 75

Get sequence
Evidence by similarity; MI0000354

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).