Stem-loop sequence dya-mir-289

AccessionMI0009698 (change log)
DescriptionDrosophila yakuba miR-289 stem-loop
Gene family MIPF0000222; mir-289
Stem-loop
   ag     a  -aa      ua   aagu    c  gcg         ccu 
5'   uuuac gu   aauaaa  uuu    ggag cu   acuccaguc   c
     ||||| ||   ||||||  |||    |||| ||   |||||||||   u
3'   aaaug ca   uuguuu  gag    ucuc ga   uggggucag   g
   ga     -  cgg      gc   ---c    u  --a         uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3L: 13706970-13707065 [+]
intergenic
Database links

Mature sequence dya-miR-289

Accession MIMAT0009118
Sequence

15 - 

uaaauauuuaaguggagccugcgacu

 - 40

Get sequence
Evidence by similarity; MI0000385

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).