Stem-loop sequence dya-mir-311b

AccessionMI0009696 (change log)
DescriptionDrosophila yakuba miR-311b stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
   -    a     -     u   u  g  u      g    uu 
5'  aaca uuuuc ggcug gga ug gc aguacu ugau  u
    |||| ||||| ||||| ||| || || |||||| ||||   
3'  uugu gaaag ccgac ccu ac cg uuauga auua  a
   a    -     u     c   u  a  -      -    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 12724551-12724629 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-311b
dya-mir-992chr2R: 12723683-12723748 [+]
dya-mir-991chr2R: 12723801-12723862 [+]
dya-mir-2498chr2R: 12723909-12723977 [+]
dya-mir-9681chr2R: 12724136-12724190 [+]
dya-mir-311bchr2R: 12724551-12724629 [+]
dya-mir-312chr2R: 12724700-12724766 [+]
dya-mir-311achr2R: 12724827-12724906 [+]
dya-mir-310chr2R: 12724935-12725022 [+]
Database links

Mature sequence dya-miR-311b-5p

Accession MIMAT0037352
Sequence

10 - 

cggcuguggauugggcuaguacu

 - 32

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dya-miR-311b-3p

Accession MIMAT0009116
Sequence

50 - 

uauugcacauuccccagccuga

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).