Stem-loop sequence dya-mir-2a-1

AccessionMI0009690 (change log)
DescriptionDrosophila yakuba miR-2a-1 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
            -      -         a    auuuc   u 
5' gcugggcuc ucaaag ugguuguga augc     cgc u
   ||||||||| |||||| ||||||||| ||||     ||| u
3' cgauucgag aguuuc accgacacu uacg     gcg g
            u      g         a    -----   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 6066955-6067030 [-]
intergenic
Clustered miRNAs
< 10kb from dya-mir-2a-1
dya-mir-2b-2chr2R: 6067224-6067306 [-]
dya-mir-2a-1chr2R: 6066955-6067030 [-]
dya-mir-2a-2chr2R: 6066564-6066635 [-]
Database links

Mature sequence dya-miR-2a

Accession MIMAT0009106
Sequence

49 - 

uaucacagccagcuuugaugagc

 - 71

Get sequence
Evidence by similarity; MI0000117

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).