Stem-loop sequence dya-mir-263b

AccessionMI0009687 (change log)
Previous IDsdya-mir-263b-1
DescriptionDrosophila yakuba miR-263b stem-loop
Gene family MIPF0000122; mir-263
Stem-loop
   u    -acu      c        g g     u     -u   c 
5'  gcug    uugagu uuggcacu g agaau cacag  uga u
    ||||    |||||| |||||||| | ||||| |||||  ||| u
3'  cggc    aauuua aaccgugg c ucuug guguc  auu u
   u    aacu      a        g g     -     uu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3L: 18445400-18445487 [-]
intergenic
Database links

Mature sequence dya-miR-263b

Accession MIMAT0009110
Sequence

15 - 

cuuggcacugggagaauucac

 - 35

Get sequence
Evidence by similarity; MI0000383

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).