Stem-loop sequence dya-mir-315

AccessionMI0009685 (change log)
Previous IDsdya-mir-315-1
DescriptionDrosophila yakuba miR-315 stem-loop
Gene family MIPF0000141; mir-315
Stem-loop
          auaa   ug          a       cuuacua 
5' cacuuau    uuu  auuguugcuc gaaagcc       u
   |||||||    |||  |||||||||| |||||||       u
3' gugaaua    aaa  uaauaacgag cuuucgg       u
          gacc   gu          -       ucgacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3L: 21787029-21787112 [-]
intergenic
Database links

Mature sequence dya-miR-315

Accession MIMAT0009084
Sequence

12 - 

uuuugauuguugcucagaaagc

 - 33

Get sequence
Evidence by similarity; MI0000427

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).