|
miRBase |
|
Stem-loop sequence dya-mir-315-1 |
|||||
| Accession | MI0009685 | ||||
| Description | Drosophila yakuba miR-315-1 stem-loop | ||||
| Gene family | MIPF0000141; mir-315 | ||||
| Stem-loop |
auaa ug a cuuacua cacuuau uuu auuguugcuc gaaagcc u ||||||| ||| |||||||||| ||||||| u gugaaua aaa uaauaacgag cuuucgg u gacc gu - ucgacaa |
||||
| Genome context |
|
||||
Mature sequence dya-miR-315 |
|
| Accession | MIMAT0009084 |
| Sequence |
12 - uuuugauuguugcucagaaagc - 33 |
| Evidence | by similarity; MI0000427 |
References |
|
| 1 |
PMID:17994087
"Evolution of genes and genomes on the Drosophila phylogeny"
Nature. 450:203-218(2007).
|