Stem-loop sequence dya-mir-286

AccessionMI0009684 (change log)
DescriptionDrosophila yakuba miR-286 stem-loop
Gene family MIPF0000225; mir-286
Stem-loop
   --         aaug    a   -    a     ucuuuuucaaaagag 
5'   uuaaaauug    gcga ugu cggu ugguc               g
     |||||||||    |||| ||| |||| |||||               u
3'   aauuuuaau    ugcu aca gcca aucag               u
   aa         aucg    c   a    g     ugaagcgaacuagcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 13623763-13623860 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-286
dya-mir-309chr2R: 13623507-13623575 [+]
dya-mir-3chr2R: 13623621-13623689 [+]
dya-mir-286chr2R: 13623763-13623860 [+]
dya-mir-4chr2R: 13623914-13623994 [+]
dya-mir-5chr2R: 13624062-13624125 [+]
dya-mir-6-1chr2R: 13624206-13624276 [+]
dya-mir-6-2chr2R: 13624342-13624415 [+]
dya-mir-6-3chr2R: 13624489-13624568 [+]
Database links

Mature sequence dya-miR-286

Accession MIMAT0009109
Sequence

64 - 

ugacuagaccgaacacucgugcu

 - 86

Get sequence
Evidence by similarity; MI0000380

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).