Stem-loop sequence dya-mir-312

AccessionMI0009683 (change log)
DescriptionDrosophila yakuba miR-312 stem-loop
Gene family MIPF0000573; mir-312
Stem-loop
   gc      u    c    a     u  -  acu 
5'   uucggu cguc cagg gcaau cu gc   a
     |||||| |||| |||| ||||| || ||   u
3'   aggccg gcag guuc cguua ga cg   u
   uu      -    a    a     u  u  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 12724700-12724766 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-312
dya-mir-992chr2R: 12723683-12723748 [+]
dya-mir-991chr2R: 12723801-12723862 [+]
dya-mir-2498chr2R: 12723909-12723977 [+]
dya-mir-9681chr2R: 12724136-12724190 [+]
dya-mir-311bchr2R: 12724551-12724629 [+]
dya-mir-312chr2R: 12724700-12724766 [+]
dya-mir-311achr2R: 12724827-12724906 [+]
dya-mir-310chr2R: 12724935-12725022 [+]
Database links

Mature sequence dya-miR-312-5p

Accession MIMAT0037351
Sequence

5 - 

cgguucgucccaggagcaauucu

 - 27

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dya-miR-312-3p

Accession MIMAT0009108
Sequence

44 - 

uauugcacuugagacggccgga

 - 65

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).