Stem-loop sequence dya-mir-219

AccessionMI0009682 (change log)
DescriptionDrosophila yakuba miR-219 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   ua    -g     u   ua    u     aa           ----   a 
5'   auuc  auuuu agc  ugau gucca  cgcaauucuug    uug u
     ||||  ||||| |||  |||| |||||  |||||||||||    ||| a
3'   uaag  uaaag ucg  gcua cgggu  gcguugggaac    aac u
   ca    aa     c   gc    -     ca           uuau   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3L: 16762590-16762686 [-]
intergenic
Database links

Mature sequence dya-miR-219

Accession MIMAT0009107
Sequence

19 - 

ugauuguccaaacgcaauucuug

 - 41

Get sequence
Evidence by similarity; MI0000358

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).