Stem-loop sequence dya-mir-124

AccessionMI0009680 (change log)
DescriptionDrosophila yakuba miR-124 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   ua     uu   c      c      ag    a    uau 
5'   cguuu  cuc ugguau cacugu  gccu uaug   u
     |||||  ||| |||||| ||||||  |||| ||||   u
3'   gcaag  gag accgua guggcg  cgga auac   c
   ac     -c   a      a      ca    -    cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 3533191-3533271 [-]
intergenic
Clustered miRNAs
< 10kb from dya-mir-124
dya-mir-124chr2R: 3533191-3533271 [-]
dya-mir-287chr2R: 3525130-3525206 [-]
Database links

Mature sequence dya-miR-124

Accession MIMAT0009105
Sequence

49 - 

uaaggcacgcggugaaugccaag

 - 71

Get sequence
Evidence by similarity; MI0000373

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).