Stem-loop sequence dya-mir-31a

AccessionMI0009678 (change log)
DescriptionDrosophila yakuba miR-31a stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
           ua       a     u         u  cg  g    g 
5' ucuguugg  aauuggc agaug cggcauagc ga  uu aaaa c
   ||||||||  ||||||| ||||| ||||||||| ||  || ||||  
3' agguaacu  uugacug ucuac gucguaucg cu  aa uuuu g
           ug       a     -         -  ag  g    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 15512022-15512113 [+]
intergenic
Database links

Mature sequence dya-miR-31a

Accession MIMAT0009103
Sequence

14 - 

uggcaagaugucggcauagcuga

 - 36

Get sequence
Evidence by similarity; MI0000420

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).