Stem-loop sequence dya-mir-210

AccessionMI0009669 (change log)
DescriptionDrosophila yakuba miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   aa   -a     ugc        gc   -         uuaga 
5'   ggu  cuuau   agcugcug  cac ugcacaaga     c
     |||  |||||   ||||||||  ||| |||||||||     u
3'   ccg  gaaug   ucggcgac  gug gcguguucu     u
   ua   ga     uua        -a   u         cagaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chrX: 16646328-16646413 [+]
intergenic
Database links

Mature sequence dya-miR-210

Accession MIMAT0009095
Sequence

52 - 

uugugcgugugacagcggcua

 - 72

Get sequence
Evidence by similarity; MI0000376

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).