Stem-loop sequence dya-mir-13a

Accession MI0009667
Description Drosophila yakuba miR-13a stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    u     c      -        a   ucgccua 
uacg aacuc ucaaag gguuguga aug       u
|||| ||||| |||||| |||||||| |||        
gugc uugag aguuuu ccgacacu uac       u
    u     u      a        a   ucaucua 
Get sequence
Genome context
Coordinates (dyak_r1.3_FB2010_02) Overlapping transcripts
3R: 15188592-15188666 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-13a
dya-mir-2c 3R: 15188361-15188462 [+]
dya-mir-13a 3R: 15188592-15188666 [+]
dya-mir-13b-1 3R: 15188737-15188804 [+]

Mature sequence dya-miR-13a

Accession MIMAT0009093
Sequence

48 - 

uaucacagccauuuugaugagu

 - 69

Get sequence
Evidence by similarity; MI0000133

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).