Stem-loop sequence dya-mir-285

AccessionMI0009661 (change log)
DescriptionDrosophila yakuba miR-285 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --  ga       -a     ga    u      a    uaucaagacaac 
5'   uc  aucgaag  acuga  ucga uggugc uaga            c
     ||  |||||||  |||||  |||| |||||| ||||             
3'   ag  uaguuuu  ugacu  agcu accacg aucu            c
   aa  aa       cg     aa    u      -    caacuuaacuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3L: 11984790-11984887 [-]
intergenic
Database links

Mature sequence dya-miR-285

Accession MIMAT0009088
Sequence

64 - 

uagcaccauucgaaaucagugc

 - 85

Get sequence
Evidence by similarity; MI0000377

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).