Stem-loop sequence dya-mir-278

AccessionMI0009659 (change log)
DescriptionDrosophila yakuba miR-278 stem-loop
Gene family MIPF0000155; mir-278
Stem-loop
   gu      acgg     c       u     a  a     g   cc 
5'   aauggu    ugcga cggauga gguuc ca cgacc ugu  u
     ||||||    ||||| ||||||| ||||| || ||||| |||  u
3'   uuaccg    auguu gccugcu ucagg gu gcugg gca  u
   gu      --ca     u       u     -  g     -   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 17445983-17446073 [-]
intergenic
Database links

Mature sequence dya-miR-278

Accession MIMAT0009086
Sequence

57 - 

ucggugggacuuucguccguuu

 - 78

Get sequence
Evidence by similarity; MI0000361

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).