Stem-loop sequence dya-mir-309

AccessionMI0009657 (change log)
DescriptionDrosophila yakuba miR-309 stem-loop
Gene family MIPF0000140; mir-3
Stem-loop
         c       c   uu u  u   c aau 
5' auuaua gacaaac uug  c gu uug c   u
   |||||| ||||||| |||  | || ||| |   u
3' uaauau cuguuug aau  g ca gac g   c
         c       a   gg u  c   c auc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 13623507-13623575 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-309
dya-mir-309chr2R: 13623507-13623575 [+]
dya-mir-3chr2R: 13623621-13623689 [+]
dya-mir-286chr2R: 13623763-13623860 [+]
dya-mir-4chr2R: 13623914-13623994 [+]
dya-mir-5chr2R: 13624062-13624125 [+]
dya-mir-6-1chr2R: 13624206-13624276 [+]
dya-mir-6-2chr2R: 13624342-13624415 [+]
dya-mir-6-3chr2R: 13624489-13624568 [+]
Database links

Mature sequence dya-miR-309

Accession MIMAT0009085
Sequence

44 - 

gcacuggguaaaguuuguccua

 - 65

Get sequence
Evidence by similarity; MI0000421

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).