Stem-loop sequence dya-mir-9a-1

Accession MI0009642
Description Drosophila yakuba miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    -     u       uau      g     -  gau 
gcua uguug cuuuggu   cuagcu uauga gu   a
|||| ||||| |||||||   |||||| ||||| ||    
cgau auaau gaagcca   gaucga auacu ca   a
    u     u       uuc      a     g  aua 
Get sequence
Genome context
Coordinates (dyak_r1.3_FB2010_02) Overlapping transcripts
3L: 20989417-20989494 [-]
intergenic

Mature sequence dya-miR-9a

Accession MIMAT0009070
Sequence

10 - 

ucuuugguuaucuagcuguauga

 - 32

Get sequence
Evidence by similarity; MI0000129

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).