Stem-loop sequence dya-mir-306

AccessionMI0009641 (change log)
DescriptionDrosophila yakuba miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
       -   c  ug  u       uu           --   - u 
5' gucc acu gg  gc cagguac  agugacucuca  aug c u
   |||| ||| ||  || |||||||  |||||||||||  ||| |  
3' cagg uga cc  cg guccgug  ucacugggggu  uac g u
       a   -  gu  u       uc           uu   a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 4404563-4404647 [-]
intergenic
Clustered miRNAs
< 10kb from dya-mir-306
dya-mir-9cchr2R: 4405077-4405168 [-]
dya-mir-306chr2R: 4404563-4404647 [-]
dya-mir-79chr2R: 4404421-4404512 [-]
dya-mir-9bchr2R: 4404240-4404330 [-]
Database links

Mature sequence dya-miR-306-5p

Accession MIMAT0009068
Previous IDsdya-miR-306
Sequence

15 - 

ucagguacuuagugacucucaa

 - 36

Get sequence
Evidence by similarity; MI0000414

Mature sequence dya-miR-306-3p

Accession MIMAT0009069
Previous IDsdya-miR-306*
Sequence

52 - 

gggggucacucugugccugugc

 - 73

Get sequence
Evidence by similarity; MI0000414

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).