Stem-loop sequence dya-mir-280

AccessionMI0009638 (change log)
DescriptionDrosophila yakuba miR-280 stem-loop
Gene family MIPF0000240; mir-280
Stem-loop
   -u      --ua     u   g                --a      
5'   ggcuuu    uguau uac uugcauaugaaaugau   uuuau 
     ||||||    ||||| ||| ||||||||||||||||   |||| a
3'   cuggag    acgua aug gacguauauuuuauua   aaaug 
   uc      uuca     u   -                gac      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2L: 16840806-16840892 [+]
intergenic
Database links

Mature sequence dya-miR-280

Accession MIMAT0009065
Sequence

10 - 

uguauuuacguugcauaugaaaugaua

 - 36

Get sequence
Evidence by similarity; MI0000365

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).